View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13989_low_11 (Length: 324)
Name: NF13989_low_11
Description: NF13989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13989_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 13 - 172
Target Start/End: Complemental strand, 3888624 - 3888464
Alignment:
| Q |
13 |
atactgaatgacttaatgtataactttatctatgtttggtgtt-gaaaaaattaacttactgatgtaataaattgtggtattaactttaacatttttgcc |
111 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3888624 |
atactcaatgacttaatgtataactttatctatgtttggtgtttgaaaaaattaacttactgatgtaataaattgtggtattaactttaacatttttgcc |
3888525 |
T |
 |
| Q |
112 |
aaccttggtaacacaagcatgtaatttaaacgatgcattaaggtgttggaaggtttttgta |
172 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3888524 |
aaccttggtaacacaagcatgtaatttaagcgatgcattaaggtgttggaaggtttttgta |
3888464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 187 - 307
Target Start/End: Complemental strand, 3888410 - 3888290
Alignment:
| Q |
187 |
aactaaaacatatttaacatgtagcaagaaagttatagacagatttaatannnnnnncatctctaattttcatattatccattatgatatgtcgcattaa |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3888410 |
aactaaaacatatttaacatgtagcaagaaagttatagacagatttaatatttttttcatctctaattttcatattatccattatgatatgtcgcattaa |
3888311 |
T |
 |
| Q |
287 |
tgttaccttgttgctgcttat |
307 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3888310 |
tgttaccttgttgctgcttat |
3888290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University