View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13989_low_13 (Length: 282)
Name: NF13989_low_13
Description: NF13989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13989_low_13 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 17 - 282
Target Start/End: Original strand, 52180000 - 52180265
Alignment:
| Q |
17 |
aatatttttcggcatgtttttctctgctgaagctgaggttcgggacactcgttggctttggaaacgaacccgaaccacaccattcgaatggttactatgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52180000 |
aatatttttcggcatgtttttctctgctgaagctgaggttcgggacactcgttggctttggaaacgaacccgaaccacaccattcgaatggttactatgt |
52180099 |
T |
 |
| Q |
117 |
ttcccattgggcattcgtccatcgggtcgtgttttcttttggtcttatgctttttatctctctcgttatcttcacatgattaggacaattttcattgttt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52180100 |
ttcccattgggcattcgtccatcgggtcgtgttttcttttggtcatatgctttttatctctctcgttatcttcacatgattaggacaattttcattgttt |
52180199 |
T |
 |
| Q |
217 |
tgaccgaaagaaaattgtcgttttttagattatttaacaactcgattattctcataatgtcatatt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52180200 |
tgaccgaaagaaaattgtcgttttttagattatttaacaactcgattattctcataatgtcatatt |
52180265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 89 - 163
Target Start/End: Original strand, 6665178 - 6665252
Alignment:
| Q |
89 |
aaccacaccattcgaatggttactatgtttcccattgggcattcgtccatcgggtcgtgttttcttttggtctta |
163 |
Q |
| |
|
|||||| || || |||||||| || ||||||||| | || || |||||||| |||||||||||||| |||||||| |
|
|
| T |
6665178 |
aaccaccccttttgaatggttcctttgtttcccacttggtatgcgtccatctggtcgtgttttcttctggtctta |
6665252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University