View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13989_low_14 (Length: 278)
Name: NF13989_low_14
Description: NF13989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13989_low_14 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 19 - 278
Target Start/End: Original strand, 47480431 - 47480690
Alignment:
| Q |
19 |
gatctaaaattaaactgtagatccaaacaactaaaaactaaatccacttaattgtaaacttaagcatcaacagtgtcctgtgattcagcagaagccaaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47480431 |
gatctaaaattaaactgtagatccaaacaactaaaaactaaatccacttaattgtaaacttaagcatcaacagtgtcctgtgattcagcagaagccaaaa |
47480530 |
T |
|
| Q |
119 |
taagctctggttcacttgcagattcacatgttccatcaattgcattgttcctccccaatgccttcaatgccaaatgtgcagctttctgtccagatatcat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47480531 |
taagctctggttcacttgcagattcacatgttccatcaattgcattgttcctccccaatgccttcaatgccaaatgtgcagctttctgtcctgatatcat |
47480630 |
T |
|
| Q |
219 |
cattgccccaaatgttggaccctacaaaccaacaaaatcgttagcacatctcaatcaaat |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47480631 |
cattgccccaaatgttggaccctacaaaccaacaaaatcgttagcacatctcaatcaaat |
47480690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 182 - 241
Target Start/End: Original strand, 31406614 - 31406673
Alignment:
| Q |
182 |
tcaatgccaaatgtgcagctttctgtccagatatcatcattgccccaaatgttggaccct |
241 |
Q |
| |
|
|||| |||||||| || || |||||||| || ||||||||||| |||||||||||||||| |
|
|
| T |
31406614 |
tcaaggccaaatgagctgccttctgtcctgaaatcatcattgctccaaatgttggaccct |
31406673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University