View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1398_high_13 (Length: 239)
Name: NF1398_high_13
Description: NF1398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1398_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 89; Significance: 5e-43; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 8 - 118
Target Start/End: Complemental strand, 22131873 - 22131766
Alignment:
| Q |
8 |
agaaggtattcaaactgtatttactattattgacttaaggataggtttgtattatttgcttgttgccttagtggcaacaacgatagcgtttagtgcagct |
107 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22131873 |
agaaggtattcgaactgtatttactatta---acttaaggataggtttgtattatttgcttgttgccttagtggcaacaacgatagcgtttagtgcagct |
22131777 |
T |
 |
| Q |
108 |
ctgcctatgct |
118 |
Q |
| |
|
||| ||||||| |
|
|
| T |
22131776 |
ctgtctatgct |
22131766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 51 - 118
Target Start/End: Original strand, 18948970 - 18949037
Alignment:
| Q |
51 |
ggtttgtattatttgcttgttgccttagtggcaacaacgatagcgtttagtgcagctctgcctatgct |
118 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
18948970 |
ggtttgtattatttgcttattgccttagtggcaacaacgatagcgtttgctgcagctctgtctatgct |
18949037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 51 - 118
Target Start/End: Complemental strand, 21961163 - 21961096
Alignment:
| Q |
51 |
ggtttgtattatttgcttgttgccttagtggcaacaacgatagcgtttagtgcagctctgcctatgct |
118 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||| |||| |||||||||| ||||||| |
|
|
| T |
21961163 |
ggtttgtattttttgctttttgccttagtggcaacaacgatagcctttactgcagctctgtctatgct |
21961096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University