View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1398_high_14 (Length: 239)
Name: NF1398_high_14
Description: NF1398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1398_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 8e-45; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 8 - 121
Target Start/End: Complemental strand, 22131873 - 22131763
Alignment:
| Q |
8 |
agaaggtattcaaactgtatttactattattgacttaaggataggtttgtattatttgcttgttgccttagtggcaacaacgatagcgtttagtgcagct |
107 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22131873 |
agaaggtattcgaactgtatttactatta---acttaaggataggtttgtattatttgcttgttgccttagtggcaacaacgatagcgtttagtgcagct |
22131777 |
T |
 |
| Q |
108 |
ctgcctatgcttct |
121 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
22131776 |
ctgtctatgcttct |
22131763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 51 - 121
Target Start/End: Original strand, 18948970 - 18949040
Alignment:
| Q |
51 |
ggtttgtattatttgcttgttgccttagtggcaacaacgatagcgtttagtgcagctctgcctatgcttct |
121 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
18948970 |
ggtttgtattatttgcttattgccttagtggcaacaacgatagcgtttgctgcagctctgtctatgcttct |
18949040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 51 - 121
Target Start/End: Complemental strand, 21961163 - 21961093
Alignment:
| Q |
51 |
ggtttgtattatttgcttgttgccttagtggcaacaacgatagcgtttagtgcagctctgcctatgcttct |
121 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||| |||| |||||||||| |||||||||| |
|
|
| T |
21961163 |
ggtttgtattttttgctttttgccttagtggcaacaacgatagcctttactgcagctctgtctatgcttct |
21961093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University