View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1398_high_3 (Length: 407)
Name: NF1398_high_3
Description: NF1398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1398_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 29 - 399
Target Start/End: Complemental strand, 1747035 - 1746668
Alignment:
| Q |
29 |
ataaattacattgtttttctttgctttcccttgaattgtatcatctggatttgattattatgtcatacttattgcaaccttcactgtcaacttaggtttt |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
1747035 |
ataaattacattgtttttctttgctttcccttgaattgtatcatctggatttgattattgtgtcatacttattgcaaccttcactgccaacataggtttt |
1746936 |
T |
|
| Q |
129 |
gcacagttgctgcagtacactgttctatgatgttactacgatagttcatatcaactttcaatttttatgttatttctttttgtacaaaactaatagacaa |
228 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| | ||||| |
|
|
| T |
1746935 |
gcacagttgctgcagcacactgttctatgctgttactaccttagttcatatcaactttcaatttttatgttatttctttttggacaaaac---ttgacaa |
1746839 |
T |
|
| Q |
229 |
taaccttaaactaattgattggccgctggattatgaagataagtgtgaatgtggtggtcttctttggttggaattgcatagataacaagtattagtcaaa |
328 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| | ||||||||||| |||||||||||||||||||||| |||||||||||||||| |||||||| || |
|
|
| T |
1746838 |
taaccttaaactaattgattgactgctggattacgtagataagtgtggatgtggtggtcttctttggttgatattgcatagataacaattattagtctaa |
1746739 |
T |
|
| Q |
329 |
ctt-atttatattttgtttgattcagccttcaggctgtgaatattggctttggtttgaagttgatattattc |
399 |
Q |
| |
|
||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||| | || |||||||||| |
|
|
| T |
1746738 |
cttgatttatattttgtttgattcagccttcgggctgt-aatattggctttggtttaaggtcgatattattc |
1746668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University