View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1398_low_13 (Length: 316)
Name: NF1398_low_13
Description: NF1398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1398_low_13 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 156 - 316
Target Start/End: Original strand, 30476866 - 30477026
Alignment:
| Q |
156 |
atagcactgatcctatttgagaatcttgatctatattccttgcgctatgatgtgtttctagtttagtgccttacttctgttgccttttttccgttcattg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30476866 |
atagcactgatcctatttgagaatcttgatctatatttcttgtgctacggtgtgtttctagtttagtgccttacttctgttgccttttttccgttcattg |
30476965 |
T |
|
| Q |
256 |
tttgaagacaatttctatgcatgagactttaggcaaagttctcaaaaaacgatgttaatga |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30476966 |
tttgaagacaatttctatgcatgagactttaggcaaagttctcaaaaaacgatgttaatga |
30477026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University