View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1398_low_29 (Length: 218)

Name: NF1398_low_29
Description: NF1398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1398_low_29
NF1398_low_29
[»] chr8 (2 HSPs)
chr8 (1-137)||(9063805-9063941)
chr8 (89-122)||(9057769-9057802)
[»] chr5 (1 HSPs)
chr5 (40-133)||(493696-493789)


Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 9063805 - 9063941
Alignment:
1 ttattaatgaagcctcaaaaaatggtttggctttaccatatacaccatattggtatggtttaacaataggtggaatgatcggaactggtgctcatggaag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9063805 ttattaatgaagcctcaaaaaatggtttggctttaccatatacaccatattggtatggtttaacaataggtggaatgatcggaactggtgctcatggaag 9063904  T
101 cacattgtcggggaaaggaagtgcggttcatgactat 137  Q
    |||||||||||||||||||||||||||||||||||||    
9063905 cacattgtcggggaaaggaagtgcggttcatgactat 9063941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 89 - 122
Target Start/End: Original strand, 9057769 - 9057802
Alignment:
89 tgctcatggaagcacattgtcggggaaaggaagt 122  Q
    |||||||||||||||||||| |||||||||||||    
9057769 tgctcatggaagcacattgtgggggaaaggaagt 9057802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 40 - 133
Target Start/End: Complemental strand, 493789 - 493696
Alignment:
40 atacaccatattggtatggtttaacaataggtggaatgatcggaactggtgctcatggaagcacattgtcggggaaaggaagtgcggttcatga 133  Q
    |||||||||||||||  |||||||| || |||||  | ||  | |||||||| |||||||| ||||||| ||| ||||||||||| ||||||||    
493789 atacaccatattggtggggtttaaccattggtggcctaattagcactggtgcacatggaagtacattgtggggtaaaggaagtgctgttcatga 493696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University