View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1398_low_30 (Length: 217)
Name: NF1398_low_30
Description: NF1398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1398_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 36 - 202
Target Start/End: Original strand, 37702489 - 37702655
Alignment:
| Q |
36 |
agagagggtttgttgggtttgtgggttttgggaccccagcagtgcatgatgggggtgttgccgagcccggtggtagttgatttgagaccggcgttggaga |
135 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
37702489 |
agagagggtttgttgggtttgtgggatttgggaacccagcagtgcatgatggtggtgttgccgagaccggtggtagttgatttgagaccggtgttggaga |
37702588 |
T |
|
| Q |
136 |
aggagaaacggtagcaacggtcgtgggaagctgtgaagctgaaacaacccgccattttagagagtga |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37702589 |
aggagaaacggtagcaacggtcgtgggaagctgtgaagctgaaacaacccgccattttagagagtga |
37702655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University