View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1398_low_7 (Length: 390)
Name: NF1398_low_7
Description: NF1398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1398_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 3e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 102 - 310
Target Start/End: Original strand, 30239666 - 30239877
Alignment:
| Q |
102 |
ctagtcaagaaggatatccaaaaattcattgaaaaaccagctcttgagaaagcaaatcctcccatggacgatactcataagggaagcaacgaatctactt |
201 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
30239666 |
ctagtcaagaaggatatcaaaaaattcattgaaaaaccagctcttgagaaagcaaatcctcccatggacgatactcataagggaagcaaagcatctactt |
30239765 |
T |
|
| Q |
202 |
cttttcatttcgcttgtgagaatgtgagtggtaacat---acatggtacacttggaatccatcatgaacctgtgttgcaactggtaatgcccactgcacc |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30239766 |
cttttcatttcgcttgtgagaatgtgagtggtaacatagcacatgttacacttggaatccatcatgaacctgtgttgcaactggtaatgcccactgcacc |
30239865 |
T |
|
| Q |
299 |
agtggttcataa |
310 |
Q |
| |
|
|||||||||||| |
|
|
| T |
30239866 |
agtggttcataa |
30239877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 305 - 384
Target Start/End: Original strand, 30239926 - 30240004
Alignment:
| Q |
305 |
tcataattgatacaaacactagtgcagaagccattgttattgatgctaacattgatattccaatagaagaagatattcat |
384 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
30239926 |
tcataattgatactaacactagtgcagaagccattgttattgatactaacattgatatt-caatagaagaagatattcat |
30240004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University