View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13990_high_11 (Length: 275)
Name: NF13990_high_11
Description: NF13990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13990_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 43091560 - 43091818
Alignment:
| Q |
1 |
aatgaagaaaagaatatctatcacaatttgaccatagctgtcatgcatgtgtagaatagtttttatctacaccgacacaattatagaaccaaagcaccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091560 |
aatgaagaaaagaatatctatcacaatttgaccatagctgtcatgcatgtgtagaatagtttttatctacaccgacacaattatagaaccaaagcaccaa |
43091659 |
T |
 |
| Q |
101 |
taaacaaactgaaaaataccataatgaatctcaacccttgatttaatccattaactccattttcatcatcagcagctttctgatcatcagaatctgcatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43091660 |
taaacaaactgaaaaataccataatgaatctcaacccttgatttaatccattaactccattttcattatcagcagctttctgatcatcagaatctgcatc |
43091759 |
T |
 |
| Q |
201 |
tgcatctggtccatctgccggtgagtctgcatcctcatccgccgccggcgccgccttct |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091760 |
tgcatctggtccatctgccggtgagtctgcatcctcatccgccgccggcgccgccttct |
43091818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University