View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13990_low_11 (Length: 290)
Name: NF13990_low_11
Description: NF13990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13990_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 18 - 259
Target Start/End: Complemental strand, 45913928 - 45913708
Alignment:
| Q |
18 |
gtttctggactcggtttccctgtcaatcttccaaatggtcgtactttctttcacagatccactggtcgtttgtctgatggacgcctcgttatcgactttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45913928 |
gtttctggactcggtttccctgtcaatcttccaaatggtcgtactttctttcacagatccactggtcgtttgtctgatggacgcctcgttatcgactttc |
45913829 |
T |
|
| Q |
118 |
tctgtaagtatttaatttcttcttctatttattcacatcaaaatctttcttactagtttcggatatttcaacttgctaagattagtttgctatctggata |
217 |
Q |
| |
|
||||||||||||| | | |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45913828 |
tctgtaagtattttaat--ttcttctatttattcacatcaaaatctttctt-------------------acttgctaagattagtttgctatctggata |
45913750 |
T |
|
| Q |
218 |
tatacatacattaacaatatagacccacatccttcgccttcg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45913749 |
tatacatacattaacaatatagacccacatccttcgccttcg |
45913708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University