View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13990_low_8 (Length: 314)
Name: NF13990_low_8
Description: NF13990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13990_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 122 - 296
Target Start/End: Original strand, 43949944 - 43950112
Alignment:
| Q |
122 |
tgattttgatgagactacaatcaatgtcccaaccaaaggcatgaaaaatgcaagggagccggaaccatctaagtcattaaatttcttgaattattaaagc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || || |
|
|
| T |
43949944 |
tgattttgatgagactacaatcaatgtcccaaccaaaggcatgaaaaatgcaagggagccggaaccatctaagtcattaaatttcctgaatttttgaa-- |
43950041 |
T |
 |
| Q |
222 |
atctttgaattgaattgaatacacatatataagtcattaaataaatagaatgttataaataatgcataccagata |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43950042 |
----ttgaattgaattgaatacacatatataagtcattaaataaatagaatgttataaataatgcataccagata |
43950112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 43949824 - 43949899
Alignment:
| Q |
1 |
tacagatccggattctctctgctcggggaaacaaac-aacgttcacgcatttgggacagagaggatcggacggtct |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
43949824 |
tacagatccggattctctctgctcggggaaacaaacaaacgttaacgcgtttgggacagagaggatcggacggtct |
43949899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University