View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13991_high_12 (Length: 207)
Name: NF13991_high_12
Description: NF13991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13991_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 29 - 190
Target Start/End: Complemental strand, 4725773 - 4725611
Alignment:
| Q |
29 |
tatatcataaggtgggaactgggaaatatgaaatgttgcnnnnnnnnntctcatcaaataatgttgcaacttaaatttagttccatgtcnnnnnnnnnn- |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4725773 |
tatatcataaggtgggaactgggaaatatgaaatgttgcaaaaaaaa-tctcatcaaataatgttgcaacttaaatttagttccatgtcaaaaaaaaaaa |
4725675 |
T |
 |
| Q |
128 |
-cttaaatttagtgtatatatatgtacctcaataaaatagttaagataaattggtgtttggaga |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4725674 |
acttaaatttagtgtatatatatgtacctcaataaaatagttaagataaattggtgtatggaga |
4725611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University