View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13991_high_4 (Length: 272)
Name: NF13991_high_4
Description: NF13991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13991_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 6 - 251
Target Start/End: Complemental strand, 26783524 - 26783279
Alignment:
| Q |
6 |
gtcgaagaatatgacgtggtggaggcatttcggcttctggaagttgcaatgcagcaatctgcaatggataccagaactggtagttatccaaacaagcccc |
105 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26783524 |
gtcgaaaaacatgacgtggtggaggcatttcggcttctggaagttgcaatgcagcaatctgcaatggataccagaactggtagttatccaaacaagcccc |
26783425 |
T |
 |
| Q |
106 |
tatactctattgtattccaccaaataaaactatatatcagactgaatccttttatcttcacaggaactattgacatggatcttataactactggtgtttc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26783424 |
tatactctattgtattccaccaaataaaactatatatcagactgaatccttttatcttcacaggaactattgacatggatcttataactactggtgtttc |
26783325 |
T |
 |
| Q |
206 |
ggcaagcgaaaggatgaggcgagaaagtttgattcaagacacccgc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26783324 |
ggcaagcgaaaggatgaggcgagaaagtttgattcaagacacccgc |
26783279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University