View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13991_low_6 (Length: 256)
Name: NF13991_low_6
Description: NF13991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13991_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 13 - 237
Target Start/End: Complemental strand, 42305655 - 42305431
Alignment:
| Q |
13 |
attattctgttcaatggtattcctgtctcataatgtatatttcaaaggtgttcattattcatatgatgaacagctagaaagcttnnnnnnncattccttc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42305655 |
attattctgttcaatggtattcctgtctcataatgtatatttcaaaggtgttcattattcatatgatgaacagctagaaagctcaaaaaaacattccttc |
42305556 |
T |
|
| Q |
113 |
taatttatatataattaatttggacttcgaatagtaaattatttatcacatatttgtaatgtgctattatcaataagacaacattgaatgcaaatcttac |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42305555 |
taatttatatataattaatatggacttcgaatagtaaattatttatcacatatttgtaatgtgctattatcaataagacaacattgaatgcaaatcttac |
42305456 |
T |
|
| Q |
213 |
caactaatgctgtttctatcacatc |
237 |
Q |
| |
|
| |||||||||| ||||| |||||| |
|
|
| T |
42305455 |
cgactaatgctgcttctaccacatc |
42305431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University