View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13993_high_18 (Length: 391)
Name: NF13993_high_18
Description: NF13993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13993_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 204 - 375
Target Start/End: Original strand, 1807894 - 1808065
Alignment:
| Q |
204 |
cctcatcatgtctaaaaacaatgatattgtaacatcaaatctttgtttttcaaatagtagaacacatttataacaaactatgctttttcaggtcagcaac |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1807894 |
cctcatcatgtctaaaaacaatgatattgtaacatcaaatctttgtttttcaaatagtagaacacatttataacaaactatgctttttcaggtcagcaac |
1807993 |
T |
 |
| Q |
304 |
ttggtactgtgtctactttaccatatttgagcccagaattaaaaggacgtaaacttctaattggtgccaatt |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1807994 |
ttggtactgtgtctactttaccatatttgagcccagaattaaaaggacgtaaacttctaattggtgccaatt |
1808065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 16 - 60
Target Start/End: Original strand, 1807707 - 1807751
Alignment:
| Q |
16 |
atgacaaaattggatacaaaaatagaccccaaatttatgggcgac |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1807707 |
atgacaaaattggatacaaaaatagaccccaaatttatgggcgac |
1807751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University