View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13993_high_37 (Length: 236)
Name: NF13993_high_37
Description: NF13993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13993_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 41929990 - 41929770
Alignment:
| Q |
1 |
atacattaatataatactatactataacaagtgggattctttattgaaggcactcaatcgggttcttgacttcatcatccttcatttataagatgaagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41929990 |
atacattaatataatactatactataacaagtgggattctttattgaaggcactcaatcgggttcttgacttcatcatccttcatttataagatgaagtc |
41929891 |
T |
 |
| Q |
101 |
tttaagcctctctctaaactatcctatgatgtctgttgaaacaatgacaaaattgtatgcagtggattcccttccgttgaatgggaccgaaatctagatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41929890 |
tttaagcctctctctaaactatcctatgatgtcagttgaaacaatgacaaaattatatgcagtggattcccttccgttgaatgggaccgaaatctagatc |
41929791 |
T |
 |
| Q |
201 |
ttacaaaatgttttttgaaga |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41929790 |
ttacaaaatgttttttgaaga |
41929770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 221
Target Start/End: Original strand, 43756950 - 43757014
Alignment:
| Q |
157 |
atgcagtggattcccttccgttgaatgggaccgaaatctagatcttacaaaatgttttttgaaga |
221 |
Q |
| |
|
||||||||||||||| | ||||||| ||||| | ||||||||||||||||| |||||||||||| |
|
|
| T |
43756950 |
atgcagtggattccccttggttgaattggaccaacatctagatcttacaaaaagttttttgaaga |
43757014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University