View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13993_low_27 (Length: 309)
Name: NF13993_low_27
Description: NF13993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13993_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 8 - 217
Target Start/End: Complemental strand, 16806144 - 16805935
Alignment:
| Q |
8 |
attattctgcacttgatcgagaacacttttgaaaattcagtgagattcttatgtattccattcgaataaagcgaccctcaatattgacacttgttagtga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16806144 |
attattctgcacttgatcgagaacacttttgaaaattcagtgagattcttatgtattccattcgaataaagtgaccctcaatattgacacttgttagtga |
16806045 |
T |
 |
| Q |
108 |
tgatattgacgaaaatgtgattggtattttaatcatgtcatatttgaagtgggtcatgaaagtaattaaacaaagaacatatgctactggtttatttgtt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16806044 |
tgatattgacgaaaatgtgattggtattttaatcatgtcatatttgaagtgggtcatgaaagtaattaaacaaagaacatatgctactggtttatttgtt |
16805945 |
T |
 |
| Q |
208 |
tgtcttgtaa |
217 |
Q |
| |
|
|||||||||| |
|
|
| T |
16805944 |
tgtcttgtaa |
16805935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 237 - 294
Target Start/End: Complemental strand, 16805915 - 16805858
Alignment:
| Q |
237 |
atacacaattagaacacacattccttaatnnnnnnntgtagaacacacgtgtgatatt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
16805915 |
atacacaattagaacacacattccttaataaaaaaatctagaacacacgtgtgatatt |
16805858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University