View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13993_low_28 (Length: 284)
Name: NF13993_low_28
Description: NF13993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13993_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 13 - 265
Target Start/End: Complemental strand, 37529118 - 37528866
Alignment:
| Q |
13 |
aatattttgcaaaaccaatataattgaaaccatgtttttaggagcttggtttcaatagaactgaacgaacacttcctattggcactaccgtaacagttgt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37529118 |
aatattttgcaaaaccaatataattgaaaccatgtttttaggagcttggtttcaatagaactgaacgaacacttcctattggcactaccgtaacagttgt |
37529019 |
T |
 |
| Q |
113 |
tggtgaggtaagttgttctaaacttgtgtttccatttttatatatggtctccttatgtttcaatattaaaagggattgttgtcgactaatcaatcatttt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37529018 |
tggtgaggtaagttgttctaaacttgtgttttcatttttatatatggtctccttatgtttcaatattaaaagggattgttgtcgactaatcaatcatttt |
37528919 |
T |
 |
| Q |
213 |
taaatatttctttggaaatatttttaaactttacgatcaggttactaaagatg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37528918 |
taaatatttctttggaaatatttttaaactttacgatcaggttactaaagatg |
37528866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University