View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13993_low_36 (Length: 243)
Name: NF13993_low_36
Description: NF13993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13993_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 224
Target Start/End: Complemental strand, 43357555 - 43357353
Alignment:
| Q |
18 |
cacagaggtcaaatatagtaaaacagcagtgtcatggggccataataacaaacacttcaaaagaaggatgcgaccttactcaaatttccaaaaccagggt |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43357555 |
cacagaagtcaaatatagtaaaacagcagtgtcatggggccataataaca----cttcaaaagaaggatgcgaccttactcaaatttccaaaaccagggt |
43357460 |
T |
 |
| Q |
118 |
ccaattgaattattatcataattacctcataacttttgctttctacgttttcttcgttttataacggtcctcattatgacatttcaggaccagtactgca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43357459 |
ccaattgaattattatcataattacctcataacttttgctttctacgttttcttcgttttataacggtcctcattatgacatttcaggaccagtactgca |
43357360 |
T |
 |
| Q |
218 |
ctcaatc |
224 |
Q |
| |
|
||||||| |
|
|
| T |
43357359 |
ctcaatc |
43357353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University