View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13993_low_43 (Length: 205)

Name: NF13993_low_43
Description: NF13993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13993_low_43
NF13993_low_43
[»] chr7 (1 HSPs)
chr7 (104-192)||(25645590-25645678)


Alignment Details
Target: chr7 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 25645678 - 25645590
Alignment:
104 ttgaacctctaacccaggtccctacctaaaacatccatatcctacaccaaagattgactgattaacatgaaacgacaatatttcttctc 192  Q
    ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||    
25645678 ttgaacctctaacccgggtccctacctaaaacatccatatcctacgccaaagattgactgattaacatgacacgacaatatttcttctc 25645590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University