View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13995_high_28 (Length: 239)
Name: NF13995_high_28
Description: NF13995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13995_high_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 6 - 135
Target Start/End: Complemental strand, 15594786 - 15594657
Alignment:
| Q |
6 |
gagtgagatgaaatgtgtatagaatgtttcaaaattgtgatttaaggtttttgcatgtttagaattatacaatttgaccgatgttcagaccacataaaat |
105 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15594786 |
gagtgaaatcaaatgtgtatagaatgtttcaaaattgtgatttaaggtttttgcatgtttagaattatacaatttgaccaatgttcagaccacataaaat |
15594687 |
T |
|
| Q |
106 |
ataaaaattagtcatttaatcaaattttac |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15594686 |
ataaaaattagtcatttaatcaaattttac |
15594657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University