View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13995_low_21 (Length: 381)
Name: NF13995_low_21
Description: NF13995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13995_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 3e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 3e-95
Query Start/End: Original strand, 169 - 375
Target Start/End: Complemental strand, 39488489 - 39488286
Alignment:
| Q |
169 |
cctaaaatatatacattaaagacatcaatgatatccaagtgaaatctcatatcagatgtggatgaaacattttcttacttaaaattataaggattcaacg |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39488489 |
cctaaaatatatacattaaagacatcaatgacatccaagtgaaatctcatatgagatgtggatgaaacattttcttacttaaaatta---ggattcaacg |
39488393 |
T |
|
| Q |
269 |
ttcaaaagttcaaactgacagtctgattaggatcacctatattttgaacagttttcttgcatgcatgcaggtcagagacactaagaggaatgttgactga |
368 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39488392 |
ttcaaaagttcaaacagacagtctgattaggatcacctatattttgaacagttttcttgcatgcatgcaggtcagagacactaagaggaatgttgactta |
39488293 |
T |
|
| Q |
369 |
tgatgtc |
375 |
Q |
| |
|
||||||| |
|
|
| T |
39488292 |
tgatgtc |
39488286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 26 - 82
Target Start/End: Complemental strand, 39488633 - 39488577
Alignment:
| Q |
26 |
atatcaaacgagtatgtaaaaacttaaagggtgtccatccatttttcacaatgtttt |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39488633 |
atatcaaacgagtatgtaaaaacttaaagggcgtccatccatttttcacaatgtttt |
39488577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University