View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13995_low_31 (Length: 236)
Name: NF13995_low_31
Description: NF13995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13995_low_31 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 2 - 236
Target Start/End: Complemental strand, 38089076 - 38088844
Alignment:
| Q |
2 |
attacgatggagccgtgattctactagtatcaatatcaatacaacatgcactaaattattattatggtcgcgcgtcccaatttggttgattgttagtgaa |
101 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38089076 |
attacgatggagccgtgattctacgagtatcaatatcaatacaacatacactaaattattattatggtcgcgcgtcccaatttggttgattgttagtgaa |
38088977 |
T |
 |
| Q |
102 |
gtaatctcaattgttatttgtcctgcaatgttgaaacataaaaaactataatatcacattagatgaaggcgagaatatgtttttgtagtcaacaatctac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38088976 |
gtaatctcaattgttatttgtcctgcaatgttgaaac--aaaaaactataatatcacattagatgaaggcgagaatatgtttttgtagtcaacaatctac |
38088879 |
T |
 |
| Q |
202 |
acattcatgcacgcaaggggctttattaaccatta |
236 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38088878 |
acattcatgcacgcaaggggcttcattaaccatta |
38088844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University