View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13997_high_8 (Length: 435)
Name: NF13997_high_8
Description: NF13997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13997_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 215 - 420
Target Start/End: Complemental strand, 29569834 - 29569629
Alignment:
| Q |
215 |
gaagtagaaggaatattgccactcatcannnnnnnaatatattttgtagataatattaatgaacattatcttggttcctttttataagttctatttgcaa |
314 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29569834 |
gaagtagaaggaatattgccactcatcatttttttaatatattttgttgataatattaatgaacattatcttggttcctttttataagttctatttgcaa |
29569735 |
T |
|
| Q |
315 |
tttggacataaattnnnnnnnntgtaattagtatatttagtatatctatttatgtgtatatgtttctcaactagacacaaaaaataatggttgctacgtt |
414 |
Q |
| |
|
||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29569734 |
ttttgacataaattaaaaaaaatgtaattagtatatttagtatatctatttatgtgtatatgtttctcaactagacacaaaaaataaaggttgctacgtt |
29569635 |
T |
|
| Q |
415 |
aaaatt |
420 |
Q |
| |
|
|||||| |
|
|
| T |
29569634 |
aaaatt |
29569629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 9 - 131
Target Start/End: Complemental strand, 29570040 - 29569918
Alignment:
| Q |
9 |
gagatgaatatttgagagtctacaagaatatgcacattacaagttaagatagaacaccaccacctacttatttatatatgaaaatttctcttggctccta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29570040 |
gagatgaatatttgagagtctacaagaatatgcacattacaagttaagatagaacaccaccacctacttatttatatatgaaaatttctcttggctccta |
29569941 |
T |
|
| Q |
109 |
agtccttgaagcccactaccgaa |
131 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
29569940 |
agtccttgaagcccactaccgaa |
29569918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University