View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13997_low_19 (Length: 230)
Name: NF13997_low_19
Description: NF13997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13997_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 41573696 - 41573483
Alignment:
| Q |
1 |
tgttaagttgtgaaacaggattgtaccataaactgtatagcaaaacaagatttggatgggattgatggatctatcacagctcatggacgacaatcattga |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41573696 |
tgttaagctgtgaaacaggattgtaccataaactgtatagcaaaacaagatttggatgggattggtggatctatcacagctcatggacgacaatcattga |
41573597 |
T |
 |
| Q |
101 |
aggaagaaacaggattttcctttgtgaattgcaacatcgttggaagtggaaaagtgtggcttggaagagcttggggagcatttgccacagtggttttttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41573596 |
aggaagaaacaggattttcctttgtgaattgcaacatcgttggaagtggaaaagtgtggcttggaagagcttggggagcatttgccacagtggttttttc |
41573497 |
T |
 |
| Q |
201 |
aacgacaaacatgt |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
41573496 |
aacgacaaacatgt |
41573483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 66 - 214
Target Start/End: Complemental strand, 41565711 - 41565563
Alignment:
| Q |
66 |
tggatctatcacagctcatggacgacaatcattgaaggaagaaacaggattttcctttgtgaattgcaacatcgttggaagtggaaaagtgtggcttgga |
165 |
Q |
| |
|
||||| |||||||||||| ||| |||| |||||| | |||||||| |||||||||||||||| ||| | ||| | ||||||||||| ||||||| |
|
|
| T |
41565711 |
tggatatatcacagctcaacaacgtgaatcgttgaagaatgaaacagggctttcctttgtgaattgtcgcattgatggtactggaaaagtgttgcttgga |
41565612 |
T |
 |
| Q |
166 |
agagcttggggagcatttgccacagtggttttttcaacgacaaacatgt |
214 |
Q |
| |
|
||| ||||| || |||||||||||||| |||||||||| ||| |||||| |
|
|
| T |
41565611 |
agaccttggagaccatttgccacagtgattttttcaacaacatacatgt |
41565563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University