View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13997_low_4 (Length: 577)

Name: NF13997_low_4
Description: NF13997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13997_low_4
NF13997_low_4
[»] chr7 (1 HSPs)
chr7 (19-191)||(12818807-12818985)


Alignment Details
Target: chr7 (Bit Score: 124; Significance: 2e-63; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 124; E-Value: 2e-63
Query Start/End: Original strand, 19 - 191
Target Start/End: Complemental strand, 12818985 - 12818807
Alignment:
19 ttttcaacttgactcagttttctctaaaatcacttcttctatggttgccttgaactcagctgcctacatattgtcacgaagctttttgcgttcgtcaaat 118  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |||||||    
12818985 ttttcaacttgactcagttttctctcaaatcacttcttctatggttgccttgaactcagctgcctatatattgtcacgaagcttttttcgtttgtcaaat 12818886  T
119 ttcggaatggaaaccaaaaacttatatgtat------aatatggctgccttttctctaaaatcatttcttctctggctg 191  Q
    |||| |||| |||||| ||||||||||||||       |||||||||||||||||||||||||||||||||||||||||    
12818885 ttcgcaatgaaaaccataaacttatatgtatgatatacatatggctgccttttctctaaaatcatttcttctctggctg 12818807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University