View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13997_low_4 (Length: 577)
Name: NF13997_low_4
Description: NF13997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13997_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 2e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 2e-63
Query Start/End: Original strand, 19 - 191
Target Start/End: Complemental strand, 12818985 - 12818807
Alignment:
| Q |
19 |
ttttcaacttgactcagttttctctaaaatcacttcttctatggttgccttgaactcagctgcctacatattgtcacgaagctttttgcgttcgtcaaat |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| ||||||| |
|
|
| T |
12818985 |
ttttcaacttgactcagttttctctcaaatcacttcttctatggttgccttgaactcagctgcctatatattgtcacgaagcttttttcgtttgtcaaat |
12818886 |
T |
|
| Q |
119 |
ttcggaatggaaaccaaaaacttatatgtat------aatatggctgccttttctctaaaatcatttcttctctggctg |
191 |
Q |
| |
|
|||| |||| |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12818885 |
ttcgcaatgaaaaccataaacttatatgtatgatatacatatggctgccttttctctaaaatcatttcttctctggctg |
12818807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University