View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13998_high_15 (Length: 370)
Name: NF13998_high_15
Description: NF13998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13998_high_15 |
 | |
|
| [»] scaffold0014 (1 HSPs) |
| | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 6e-96; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 144 - 345
Target Start/End: Complemental strand, 20212912 - 20212711
Alignment:
| Q |
144 |
atccgatttatatgttttatacagcaagttgatgaagactttggaatgtacctcaagcaatatggttttgtggatgtaaaactttgtgctgataatgaca |
243 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| || |||||||||||||||| |||||||| || |
|
|
| T |
20212912 |
atccgatttatatgttttatacaacaagttgatgaagactttggaatgtacctcaagcaatatgatttcgtagatgtaaaactttgtgttgataatggca |
20212813 |
T |
|
| Q |
244 |
atgaagagaaatttaaggtgtatttcctgaatgatgcaaaattgacaacacagtttggaatcatgtgggatcagttctgcaaaaacagcaacttcagaat |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20212812 |
atgaagagaaatttaaggtgtatttcctgaatgatgcaaaattgacaacacagtttggaatcatgtgggatcagttctgcaaaaacagcaacttcagaat |
20212713 |
T |
|
| Q |
344 |
tg |
345 |
Q |
| |
|
|| |
|
|
| T |
20212712 |
tg |
20212711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 12 - 78
Target Start/End: Complemental strand, 20213044 - 20212978
Alignment:
| Q |
12 |
atcatcaatcgaactgcatttttcgattctctacttactgaagatgattttctcagcccaatgaagg |
78 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20213044 |
atcatcaatcgaactgcatatttcgattctctacttactgaagatgactttctcagcccaatgaagg |
20212978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 285 - 352
Target Start/End: Original strand, 26148481 - 26148548
Alignment:
| Q |
285 |
ttgacaacacagtttggaatcatgtgggatcagttctgcaaaaacagcaacttcagaattggacaaac |
352 |
Q |
| |
|
||||| ||||| ||||||||| |||||||||| |||||||||| || ||||||||||||||| ||||| |
|
|
| T |
26148481 |
ttgactacacaatttggaatcctgtgggatcatttctgcaaaaccaacaacttcagaattggccaaac |
26148548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 273 - 326
Target Start/End: Original strand, 131932 - 131985
Alignment:
| Q |
273 |
aatgatgcaaaattgacaacacagtttggaatcatgtgggatcagttctgcaaa |
326 |
Q |
| |
|
||||||| ||||||||||||||| ||||||| || ||||||||| ||||||||| |
|
|
| T |
131932 |
aatgatggaaaattgacaacacaatttggaaccaagtgggatcatttctgcaaa |
131985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 220 - 301
Target Start/End: Complemental strand, 114675 - 114594
Alignment:
| Q |
220 |
taaaactttgtgctgataatgacaatgaagagaaatttaaggtgtatttcctgaatgatgcaaaattgacaacacagtttgg |
301 |
Q |
| |
|
||||||||||||||||||||| | | ||||| |||||| || || ||||| ||||||| ||| || |||||||||||||| |
|
|
| T |
114675 |
taaaactttgtgctgataatggccacgaagaaaaatttccagtttacttcctcaatgatgaaaatttaacaacacagtttgg |
114594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University