View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13998_high_29 (Length: 234)
Name: NF13998_high_29
Description: NF13998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13998_high_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 41685874 - 41686095
Alignment:
| Q |
1 |
tgattttagcattccattgctattttaagcttccttgtggcagtaacgttctacaacactctcttgagagtgttcataaaactatgatggtcaacaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41685874 |
tgattttagcattccattgctattttaagcttccttgtggcagtaacgttctacaacactctcttgagagtgttcataaaactatgatggtcaacaattc |
41685973 |
T |
|
| Q |
101 |
atatgtcaatgtaattgacaatcattcttctatcacaatgatgcctaaggagactgaaggatctcttgtaaaagttccggagatgacatcaatttcggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41685974 |
atatgtcaatgtaattgacaatcattcttctatcacaatgatgcctaaggagactgaaggatctcttgtaaaagttccggagatgacatcaatttcggaa |
41686073 |
T |
|
| Q |
201 |
atggacaagctattgcttcaaa |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41686074 |
atggacaagctattgcttcaaa |
41686095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 103 - 222
Target Start/End: Original strand, 51205614 - 51205733
Alignment:
| Q |
103 |
atgtcaatgtaattgacaatcattcttctatcacaatgatgcctaaggagactgaaggatctcttgtaaaagttccggagatgacatcaatttcggaaat |
202 |
Q |
| |
|
||||||||||||| || || ||||||||||| || ||||||||| |||| | | |||||| |||||||||||||| | |||||||| || || || |
|
|
| T |
51205614 |
atgtcaatgtaatgaaccataattcttctatcgtaactgtgcctaaggtgactacaagttctcttataaaagttccggaggtaacatcaatatcagatat |
51205713 |
T |
|
| Q |
203 |
ggacaagctattgcttcaaa |
222 |
Q |
| |
|
||| ||| |||||||||||| |
|
|
| T |
51205714 |
ggataagttattgcttcaaa |
51205733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University