View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13998_high_34 (Length: 216)

Name: NF13998_high_34
Description: NF13998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13998_high_34
NF13998_high_34
[»] chr6 (2 HSPs)
chr6 (135-203)||(2333056-2333121)
chr6 (19-52)||(2333120-2333153)


Alignment Details
Target: chr6 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 2333121 - 2333056
Alignment:
135 cttcttgggaaattttgatcgacttccagatgttgctagtaacgtgttgttgtatcatgagagataact 203  Q
    |||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||    
2333121 cttcttgggaaattttgatcgacttccagatgttgctagtaac---atgttgtatcatgagagataact 2333056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 52
Target Start/End: Complemental strand, 2333153 - 2333120
Alignment:
19 tatagtccggaaggaataatcttgtagcacatct 52  Q
    ||||||||||||||||||||||||||||||||||    
2333153 tatagtccggaaggaataatcttgtagcacatct 2333120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University