View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13998_high_34 (Length: 216)
Name: NF13998_high_34
Description: NF13998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13998_high_34 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 2333121 - 2333056
Alignment:
| Q |
135 |
cttcttgggaaattttgatcgacttccagatgttgctagtaacgtgttgttgtatcatgagagataact |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2333121 |
cttcttgggaaattttgatcgacttccagatgttgctagtaac---atgttgtatcatgagagataact |
2333056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 52
Target Start/End: Complemental strand, 2333153 - 2333120
Alignment:
| Q |
19 |
tatagtccggaaggaataatcttgtagcacatct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2333153 |
tatagtccggaaggaataatcttgtagcacatct |
2333120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University