View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13998_low_10 (Length: 426)
Name: NF13998_low_10
Description: NF13998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13998_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 3e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 107 - 281
Target Start/End: Complemental strand, 23434110 - 23433936
Alignment:
| Q |
107 |
acacatgattacgcattcctacttcttggttcttccctgcaatttctcccaacaagctgggatacccacaaacataataatagttatcttacaaaataac |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23434110 |
acacatgattacgcattcctacttcttggttcttccctgcaatttctcccaacaagctgggatacccgcaaacataataatagttatcttacaaaataac |
23434011 |
T |
 |
| Q |
207 |
tataaaacttttgattaattaaagaccctttatttctttaactctagaactagttgaatctcattatgttcttct |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23434010 |
tataaaacttttgattaattaaagaccctttatttctttaactctagaactggttgaatctcattatgttcttct |
23433936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 349 - 410
Target Start/End: Complemental strand, 23433869 - 23433808
Alignment:
| Q |
349 |
cacaagcttaatctcattctattcttcggggtttttggggttagttttgtttgcttaatatt |
410 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23433869 |
cacaagcttaatctcattctattcttcggggtttctggggttagttttgtttgcttaatatt |
23433808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University