View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13998_low_18 (Length: 333)
Name: NF13998_low_18
Description: NF13998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13998_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 160 - 320
Target Start/End: Original strand, 55458398 - 55458557
Alignment:
| Q |
160 |
acattaatttcttacttttctccatnnnnnnnttagagtttgttttagaatttttgtgtactattataccttttacgtcaattgcgtaaacaaatgcata |
259 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55458398 |
acattaatttcttacttttctccataaaaaa-ttagagtttgttttagaatttttgtgtactattataccttttacgtcaattgcgtaaacaaatgcata |
55458496 |
T |
|
| Q |
260 |
tcacaataaacatgcaaaatcccccacatgaaccctggcacacatcctcgctcgcgtattc |
320 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55458497 |
tcacactaaacatgcaaaatcccccacatgaaccctggcacacatcctcgctcgcgtattc |
55458557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 17 - 104
Target Start/End: Original strand, 55458250 - 55458337
Alignment:
| Q |
17 |
atttacaagttggcattttaaagcaaatt-ggcatgtcttagactcttaagtcttgccgttaccgggtgtagggtattttttatttctt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55458250 |
atttacaagttggcattttaaagcaaatttggcatgtcttagactctta-gtcttgccgttaccgggtgtagggtattttttatttctt |
55458337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University