View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13998_low_20 (Length: 315)
Name: NF13998_low_20
Description: NF13998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13998_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 12 - 270
Target Start/End: Complemental strand, 28340861 - 28340600
Alignment:
| Q |
12 |
aagaaggatttttgtttgtaagataggcagtctctgtcccaaaaaatagggagtcattaggtcagtcgacagacactatgggaaaataaaagaattt--a |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
28340861 |
aagaaggatttttgtttgtaagataggcagtctctgtcccaaaaaatagggagtcattaggtcagtcgacagacactatgggaaaataaaagaatttaga |
28340762 |
T |
|
| Q |
110 |
gatacttcattgggttgtatggttcaaaaaccaaaatattattgtagcgattgataaatttaaagaaaaatgctcaaagttttc--aagaatatatattt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28340761 |
gatacttcattgggttgtatggttcaaaaaccaaaatatta-tgtagcgattgataaatttaaagaaaaatgctcaaagttttcaaaagaatatatattt |
28340663 |
T |
|
| Q |
208 |
tgtataatttacttttttagcagtttaagagtctttctttagtattcaatgaactgttaaaca |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28340662 |
tgtataatttacttttttagcagtttaagagtctttctttagtattcaatgaactgttaaaca |
28340600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 271 - 299
Target Start/End: Complemental strand, 28340259 - 28340231
Alignment:
| Q |
271 |
cttaagatttaagattatattttcattct |
299 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28340259 |
cttaagatttaagattatattttcattct |
28340231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 205 - 252
Target Start/End: Original strand, 18054514 - 18054563
Alignment:
| Q |
205 |
ttttgtataatttactttt--ttagcagtttaagagtctttctttagtat |
252 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
18054514 |
ttttatataatttacttttttttagcagtttaagagcctttctttagtat |
18054563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 205 - 252
Target Start/End: Complemental strand, 17926652 - 17926603
Alignment:
| Q |
205 |
ttttgtataatttactttttt--agcagtttaagagtctttctttagtat |
252 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
17926652 |
ttttatataatttacttttttttagcagtttaagagcctttctttagtat |
17926603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University