View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13998_low_21 (Length: 311)

Name: NF13998_low_21
Description: NF13998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13998_low_21
NF13998_low_21
[»] chr2 (2 HSPs)
chr2 (19-135)||(37573463-37573586)
chr2 (216-300)||(37573651-37573735)


Alignment Details
Target: chr2 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 19 - 135
Target Start/End: Original strand, 37573463 - 37573586
Alignment:
19 agagattgtacacacgtacgtacagtacagctagctagctgtgcgagggagtgagtgagcagtaaacaatg----gtttgttatgtc---tcttcttctg 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||   ||||||||||    
37573463 agagattgtacacacgtacgtacagtacagctagctagctgtgcgagggagtgagtgagcagtaaacaatggtttgtttgttatgtctcttcttcttctg 37573562  T
112 ctgtagccgttttgtgcagtgcag 135  Q
    ||||||||||||||||||||||||    
37573563 ctgtagccgttttgtgcagtgcag 37573586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 216 - 300
Target Start/End: Original strand, 37573651 - 37573735
Alignment:
216 cacgcaggctacaccttcttttcatcttttgtttttgcatttatcatatcatataacatgtcatcaccatatggtttatttgtgc 300  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37573651 cacgcacgctacaccttcttttcatcttttgtttttgcatttatcatatcatataacatgtcatcaccatatggtttatttgtgc 37573735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University