View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13998_low_21 (Length: 311)
Name: NF13998_low_21
Description: NF13998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13998_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 19 - 135
Target Start/End: Original strand, 37573463 - 37573586
Alignment:
| Q |
19 |
agagattgtacacacgtacgtacagtacagctagctagctgtgcgagggagtgagtgagcagtaaacaatg----gtttgttatgtc---tcttcttctg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
37573463 |
agagattgtacacacgtacgtacagtacagctagctagctgtgcgagggagtgagtgagcagtaaacaatggtttgtttgttatgtctcttcttcttctg |
37573562 |
T |
 |
| Q |
112 |
ctgtagccgttttgtgcagtgcag |
135 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37573563 |
ctgtagccgttttgtgcagtgcag |
37573586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 216 - 300
Target Start/End: Original strand, 37573651 - 37573735
Alignment:
| Q |
216 |
cacgcaggctacaccttcttttcatcttttgtttttgcatttatcatatcatataacatgtcatcaccatatggtttatttgtgc |
300 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37573651 |
cacgcacgctacaccttcttttcatcttttgtttttgcatttatcatatcatataacatgtcatcaccatatggtttatttgtgc |
37573735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University