View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13998_low_22 (Length: 301)
Name: NF13998_low_22
Description: NF13998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13998_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 15 - 293
Target Start/End: Complemental strand, 34899679 - 34899401
Alignment:
| Q |
15 |
aatattgacgacgatgagaaggagtctttggccgggttgagttctgttccacctcgtcgcaaaacacattcgtatagccaacagctacgagacacgtcta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899679 |
aatattgacgacgatgagaaggagtctttggccgggttgagttctgttccacctcgtcgcaaaacacattcgtatagccaacagctacgagacacgtcta |
34899580 |
T |
 |
| Q |
115 |
cacacaaacggcatcatcaagtccgtaagcacagtcttgatgatagccttatatcgaataacatcgtcgagtcttcttctttttatgaggagtctgacac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899579 |
cacacaaacggcatcatcaagtccgtaagcacagtcttgatgatagccttatatcgaataacatcgtcgagtcttcttctttttatgaggagtctgacac |
34899480 |
T |
 |
| Q |
215 |
ggatgatgatgacttttttgctaattcaaattctgttggtgctgaggactacattgaaagtggtgggatttctgatgat |
293 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899479 |
ggatgatgatgactttttcgctaattcaaattctgttggtgctgaggactacattgaaagtggtgggatttctgatgat |
34899401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University