View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13998_low_35 (Length: 225)

Name: NF13998_low_35
Description: NF13998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13998_low_35
NF13998_low_35
[»] chr8 (1 HSPs)
chr8 (25-224)||(3422763-3422962)


Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 25 - 224
Target Start/End: Complemental strand, 3422962 - 3422763
Alignment:
25 ttagtgtaaatggaaaataaattttaatcaaattattgcaagtagatcataaatgctcaaaagagtacccacatttgcttgagattttgggtgtgatcaa 124  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3422962 ttagtgtaaatggaaaataaattttaatcaaattattgcaagtagatcataaatgctcaaaagagtacccacatttgcttgagattttgggtgtgatcaa 3422863  T
125 aacctattcaaacaattgtgctgatgtggttaacgagttttcactaatcatttagaaaaatataaatttgatttttggataccataatcaattatattta 224  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||  ||||||||    
3422862 aacctattcaaacaattgtgttgatgtggttaacgagttttcactaatcatttagaaaaacataaatttgatttttggatatcataatcagctatattta 3422763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University