View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13998_low_37 (Length: 201)
Name: NF13998_low_37
Description: NF13998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13998_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 179
Target Start/End: Original strand, 33372106 - 33372267
Alignment:
| Q |
18 |
agatcatgtattcgttttcgtcgatgaaaacagtgcggccattttggtttagtgcagaccagagaagtgactcatgggtgagaccaaagatgaggaagtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33372106 |
agatcatgtattcgttttcgtcgatgaaaacagtgcggccattttggtttagtgcagaccagagaagtgactcatgggtgagaccaaagatgaggaagtt |
33372205 |
T |
 |
| Q |
118 |
ggggtgtggtgtaaggtgaagagtggttgttatagcgttgatttcttcaaaggacatggatt |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33372206 |
ggggtgtggtgtaaggtgaagagtggttgttatagcgttgatttcttcaaaggacatggatt |
33372267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 26 - 179
Target Start/End: Original strand, 33367913 - 33368066
Alignment:
| Q |
26 |
tattcgttttcgtcgatgaaaacagtgcggccattttggtttagtgcagaccagagaagtgactcatgggtgagaccaaagatgaggaagttggggtgtg |
125 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||| | || ||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||| || |
|
|
| T |
33367913 |
tattcgttttcatcgatgaaaacagtgcgaccattgttattcagtgcagaccagagaagggactcttgggtgagaccaaagataaggaagttggggtttg |
33368012 |
T |
 |
| Q |
126 |
gtgtaaggtgaagagtggttgttatagcgttgatttcttcaaaggacatggatt |
179 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
33368013 |
gtgtaaggtgaagagtggttgttatggcgttgatttctgaaaaggacatggatt |
33368066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University