View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13999_high_26 (Length: 298)
Name: NF13999_high_26
Description: NF13999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13999_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 16 - 288
Target Start/End: Complemental strand, 42914212 - 42913936
Alignment:
| Q |
16 |
gtctcaaccctcccgttcataaggaaaaattatcttgtaatcaccaaaatttgattaggaggtaagtaaattctgaacaaaaattgttttagataggatt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42914212 |
gtctcaaccctcccgttcataaggaaaaattatcttgtaatcaccaaaatttgattaggaggtaagtaaattctgaataaaaattgttttagataggatt |
42914113 |
T |
 |
| Q |
116 |
cgaactcaggttctactaaacaatgcgttt----taagttcattgttcacttttgttttactcaaccttgtctaataaacaacaatcgaattttgatctg |
211 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42914112 |
cgaacttaggttctactaaacaatgcgtttaacttaagttcattgttcacttttgttttactcagccttgtctaataaacaacaatcgaattttgatctg |
42914013 |
T |
 |
| Q |
212 |
aatatgattctgcaggttgtatcagcacaaactgctctctccgacgatacggctcagttatcgttgaaatctgatga |
288 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42914012 |
aatatgattctgcaggttgtatcagcacagactgctctctccgacgatacggctcagttatcgttgaaatctgatga |
42913936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University