View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13999_high_36 (Length: 238)

Name: NF13999_high_36
Description: NF13999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13999_high_36
NF13999_high_36
[»] chr4 (1 HSPs)
chr4 (17-226)||(22569280-22569489)


Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 17 - 226
Target Start/End: Original strand, 22569280 - 22569489
Alignment:
17 aagaacctccctggatactcttggatgcggcagccattattctggtgagtattgtgcagattgtattttctgctgaggagagtcacgtggttgttgctgt 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
22569280 aagaacctccctggatactcttggatgcggcagccattattctggtgagttttgtgcagattgtattttctgctgaggagagtcacgtggttgttgctgt 22569379  T
117 ggcggtggaagagagtcggatggtggttgttggtgtgggggagaaggagagtcttgcattgattcttgttgctgcgttggagaatctgatgcaggttgtt 216  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
22569380 ggcagtggaagagagtcggatggtggttgttggtgtgggggagaaggagagtcttgcattgattcttgttgctgcgttggagaatctggtgcaggttgtt 22569479  T
217 ccatgatgat 226  Q
    ||||| ||||    
22569480 ccatggtgat 22569489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University