View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13999_high_36 (Length: 238)
Name: NF13999_high_36
Description: NF13999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13999_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 17 - 226
Target Start/End: Original strand, 22569280 - 22569489
Alignment:
| Q |
17 |
aagaacctccctggatactcttggatgcggcagccattattctggtgagtattgtgcagattgtattttctgctgaggagagtcacgtggttgttgctgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22569280 |
aagaacctccctggatactcttggatgcggcagccattattctggtgagttttgtgcagattgtattttctgctgaggagagtcacgtggttgttgctgt |
22569379 |
T |
 |
| Q |
117 |
ggcggtggaagagagtcggatggtggttgttggtgtgggggagaaggagagtcttgcattgattcttgttgctgcgttggagaatctgatgcaggttgtt |
216 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22569380 |
ggcagtggaagagagtcggatggtggttgttggtgtgggggagaaggagagtcttgcattgattcttgttgctgcgttggagaatctggtgcaggttgtt |
22569479 |
T |
 |
| Q |
217 |
ccatgatgat |
226 |
Q |
| |
|
||||| |||| |
|
|
| T |
22569480 |
ccatggtgat |
22569489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University