View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13999_low_30 (Length: 282)
Name: NF13999_low_30
Description: NF13999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13999_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 43541964 - 43541702
Alignment:
| Q |
1 |
acagactgctattatacaaatctatatagttgtatagatgcatacgacctttgttttaaagnnnnnnntgttagtaatttagttgatagaaatatgaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43541964 |
acagactgctattatacaaatctatatagttgtatagatgcatacgacctttgttttaaagaaaaaaatgttagtaatttagttgatagaaatatgaaaa |
43541865 |
T |
|
| Q |
101 |
agggattccaatcttgaaaatgctctctttctacaactcttacgtagcttcttaaatcaaacaaactcttatgtctctatttaggatcccactatctatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
43541864 |
agggattccaatcttgaaaatgctctctttctacaactcttacgttgcttcttaaatcaaacaaactcttatgtctctatttaggatcccattatctaag |
43541765 |
T |
|
| Q |
201 |
gtatacggtacaacaggctgcagagaagccaatttggttatttagctgacaaaacatacaagc |
263 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43541764 |
gtatacagtacaaccggctgcagagaagccaatttggttatttagctgacaaaacatacaagc |
43541702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University