View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13999_low_33 (Length: 265)
Name: NF13999_low_33
Description: NF13999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13999_low_33 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 13 - 265
Target Start/End: Complemental strand, 22665779 - 22665527
Alignment:
| Q |
13 |
caaagggtaaccgtgactggacatatagatgcaaatgagatcttagatgaagtgaggagcacaggaaaaacagctgatatgtggtccttagttccctaca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22665779 |
caaagggtaaccgtgactggacatatagatgcaaatgagatcttagatgaagtgaggagcacaggaaaaacagctgatatgtggtccttagttccctaca |
22665680 |
T |
 |
| Q |
113 |
atttagtggcttatccttatgcaattggggcatatgacatgaaagcaccaactggtttcgtcagaggtgtccctcaagctgtgggtgaccctaagtctcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22665679 |
atttagtggcttatccttatgcaattggggcatatgacatgaaagcaccaactggtttcgtcagaggtgtccctcaagctgtgggtgaccctaagtctcc |
22665580 |
T |
 |
| Q |
213 |
agagttgaagatgatggcactttttaatgctgacaatgcaaacgcatgttcaa |
265 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22665579 |
agagttgaagatgatggcactttttaatgatgacaatgcaaacgcatgttcaa |
22665527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University