View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13999_low_34 (Length: 253)
Name: NF13999_low_34
Description: NF13999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13999_low_34 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 10 - 253
Target Start/End: Complemental strand, 4412068 - 4411825
Alignment:
| Q |
10 |
tagattatacttacggatggaggaaattctgaaacatccaatcacgtagaacggaaacagatctttctggcaagcccctttggggcctccataactgatc |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4412068 |
tagataatacttacggatggaggaaattctgaaacatccaatcacgtagaacggaaacagatctttctggcaagcccctttggggcctccataactgatc |
4411969 |
T |
 |
| Q |
110 |
tttccttttcaactgttgaagagcccattgcttttgaatgaatgaagtttcaacagataattccttatcctcttctgaccatgaactgttaaaatttgat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4411968 |
tttccttttcaactgttgaagagcccattgcttttgaatgaatgaagtttcaacagataattccttatcctcttctgaccatgaactgttaaaatttgat |
4411869 |
T |
 |
| Q |
210 |
cccatggaaagaatatgtttgctaatcctctctctcaagtcctt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4411868 |
cccatggaaagaatatgtttgctaatcctctctctcaagtcctt |
4411825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University