View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13999_low_40 (Length: 227)
Name: NF13999_low_40
Description: NF13999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13999_low_40 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 15 - 227
Target Start/End: Complemental strand, 38965499 - 38965288
Alignment:
| Q |
15 |
cttttaacagtcatgttatatgttcatacaatataattcataccttatttgttctttgttactcttttatggttcatccaagcacaattttttgttggaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38965499 |
cttttaacagtcatgttatatgttcatacaatataattcataccttattt-ttctttgttactcttttatggttcatccaagcacaattttttgttggaa |
38965401 |
T |
 |
| Q |
115 |
aatctttcaagataactcaaattttagagattgttggcggaaggattgattttcaattgaaggttaatgtgattagtcctgactgtcccaacccaacaca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38965400 |
aatctttcaagataactcaaattttagagattgttggcggaaggattgattttcaattgaaggttaatgtgattagtcctgactgtcccaacccaacaca |
38965301 |
T |
 |
| Q |
215 |
ggaaggaagtctt |
227 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38965300 |
ggaaggaagtctt |
38965288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University