View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1399_high_19 (Length: 409)
Name: NF1399_high_19
Description: NF1399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1399_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 13 - 380
Target Start/End: Original strand, 44352622 - 44352989
Alignment:
| Q |
13 |
gagaggtgaataacaatgcagagtgattctatagttgggtgaaattgttgttgagattgtgattttgcccagttgaagagttttaagacaagtgggtaat |
112 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44352622 |
gagaggtgaacaacaatgcagagtgattctagagttgggtgaaattgttgttgagattgtgattttgcccagttgaagaggtttaagacaagtgggtaat |
44352721 |
T |
 |
| Q |
113 |
cgtttttgaggttgatgagaacccaaatgagatgggacggtttaaagcgagattcgtagggtttaagaacgcggcggaagggttcgagatggcggcgttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44352722 |
cgtttttgaggttgatgagaacccaaatgagatgggacggtttaaagcgagattcgtagggtttaagaacgcggcggaagggttcgagatggcggcgttt |
44352821 |
T |
 |
| Q |
213 |
gagggtagtggtgacgtggcggacgaggtcggtgtcggagatagaaggatttcgtggggaatagtcgggaaatgggcgaggggttgttgagaagttttta |
312 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44352822 |
gagggtagtggttacgcggcggacgaggtcggtgtcggagatagaaggatttcgtggggaatagtcgggaaatgggcgaggggttgttgagaagttttta |
44352921 |
T |
 |
| Q |
313 |
gcggcggaggagaatgatgaagaaagggaatgtgttgtaagatatgagatgatggtggatgttgttct |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44352922 |
gcggcggaggagaatgatgaagaaagggaatgtgttgtaagataggagatgatggtggatgttgttct |
44352989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University