View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1399_high_21 (Length: 401)
Name: NF1399_high_21
Description: NF1399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1399_high_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 30 - 312
Target Start/End: Original strand, 24687696 - 24687980
Alignment:
| Q |
30 |
tgctttctttatgtcaattgttcatccgtgagtccttgnnnnnnnnnnnnn--gtatagttccaagctaagcctcaacatgttttctgtctttactcaca |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24687696 |
tgctttctttatgtcaattgttcatccgtgagtccttgtctctctctctctctgtatagttccaagctaagcctcaacatgttttctgtctttactcaca |
24687795 |
T |
|
| Q |
128 |
ttcttcttcttttctctcccctccacaaatcctgatgctacttttttattactagtattaaacacgatataccagacacgtttttcatcagaggtgttag |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24687796 |
ttcttcttcttttctctcccctccacaaatcctgatactacttttttattactagtattaaacacgatataccagacatgtttttcatcagaggtgttag |
24687895 |
T |
|
| Q |
228 |
aaacatgtcacatatattaaacacgacactgatacaaacacgtcatacatgtaaaaatgtgaacaaaagaaaaaacaagtccatt |
312 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24687896 |
aaacatgtcatatatattaaacacgacactgatacaaacacgtcacacatgtaaaaatgtgaacaaaagaaaaaacaagtccatt |
24687980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 318 - 388
Target Start/End: Original strand, 24688014 - 24688085
Alignment:
| Q |
318 |
tgtctcatacactagacacgattttcatcaga-gtgttagtgcttatgagctagtaatttttatttactttc |
388 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24688014 |
tgtcttatacactagacacgattttcatcagaagtgttagtgcttatgagctagtaatttttatttactttc |
24688085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University