View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1399_high_32 (Length: 353)
Name: NF1399_high_32
Description: NF1399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1399_high_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 329; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 5 - 345
Target Start/End: Original strand, 43054796 - 43055136
Alignment:
| Q |
5 |
tctccaacaaaatatttagtgacaattctttacgttatggatccagaatatgatagttgctaggtcaaatacagttgttattattattattgctgttatt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43054796 |
tctccaacaaaatatttagtgacaattctttacgttatggatccagaatatgatagttgctaggtcaaatacagttgttattattattattactgttatt |
43054895 |
T |
|
| Q |
105 |
atttctggcgtccagacgggcacaattggctagggatgcatatgtttagtccctagaaaattacccagtttcagttatgtttatgacttctgtataaatg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43054896 |
atttctggcgtccagacgggcacaattggctagggatgcatatgtttagtccctagaaaattacccagtttcggttatgtttatgacttctgtataaatg |
43054995 |
T |
|
| Q |
205 |
tatactgctgatcatgttcaatgtttatgttttctgttgcaggaaaaagttgtttgtctcacttgcggcgatataggttttccagaggtccgggtttttt |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43054996 |
tatactgctgatcatgttcaatgtttatgttttctgttgcaggaaaaagttgtttgtctcacttgcggcgatataggttttccagaggtcagggtttttt |
43055095 |
T |
|
| Q |
305 |
gcaacaattgcaaggattgtgctcttcataggtgcttatac |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43055096 |
gcaacaattgcaaggattgtgctcttcataggtgcttatac |
43055136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 272 - 337
Target Start/End: Complemental strand, 43186084 - 43186018
Alignment:
| Q |
272 |
gcgatataggttttccagaggtccg-ggttttttgcaacaattgcaaggattgtgctcttcataggt |
337 |
Q |
| |
|
||||| |||||||||||||||| | ||||||||||||||| ||| ||| |||||||||||| |||| |
|
|
| T |
43186084 |
gcgatgtaggttttccagaggttagaggttttttgcaacaagtgccaggcttgtgctcttcacaggt |
43186018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 255 - 292
Target Start/End: Original strand, 44804432 - 44804469
Alignment:
| Q |
255 |
tgtttgtctcacttgcggcgatataggttttccagagg |
292 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
44804432 |
tgtttgtctcacttgcggtgatgtaggttttccagagg |
44804469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University