View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1399_high_46 (Length: 274)
Name: NF1399_high_46
Description: NF1399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1399_high_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 43055541 - 43055785
Alignment:
| Q |
1 |
ttgcaatcacatgtttttaagtacttannnnnnncttgcaggtactgtttagacggacctgtgatttttaccaaggaagttatatggttatgtgaggatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43055541 |
ttgcaatcacatgtttttaagtacttctttttttcttgcaggtactgtttagacggacctgtgatttttaccgaggaagttatatggttatgtgaggatt |
43055640 |
T |
 |
| Q |
101 |
gtgacgaagaaacaggaccgtgtccaatgactgactctgaaactgatgattcaataacatcagaagatgattttaaggcacgacctattcttgatgcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43055641 |
gtgacgaagaaacaggaccgtgtccaatgactgactctgaaactgatgattcaataacatcagaagatgattttaaggcacgacctattcttgatgcaaa |
43055740 |
T |
 |
| Q |
201 |
ctggaggtatgaattttgttttgctttatttgaaaatcggcgaac |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43055741 |
ctggaggtatgaattttgttttgctttatttgaaaatcggcgaac |
43055785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 39 - 104
Target Start/End: Original strand, 44805141 - 44805206
Alignment:
| Q |
39 |
caggtactgtttagacggacctgtgatttttaccaaggaagttatatggttatgtgaggattgtga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||| |||||||| |||||||| ||||| |
|
|
| T |
44805141 |
caggtactgtttagacggacctgtgatttttaccgatgaagtgatatggttttgtgaggactgtga |
44805206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 39 - 110
Target Start/End: Complemental strand, 11788807 - 11788736
Alignment:
| Q |
39 |
caggtactgtttagacggacctgtgatttttaccaaggaagttatatggttatgtgaggattgtgacgaaga |
110 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||| | || ||||| |||| |||||||||||||| ||||| |
|
|
| T |
11788807 |
caggtattgtttagacgggcctgtgatttttacggatgaggttatttggtattgtgaggattgtgaagaaga |
11788736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 39 - 69
Target Start/End: Complemental strand, 17543081 - 17543051
Alignment:
| Q |
39 |
caggtactgtttagacggacctgtgattttt |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
17543081 |
caggtactgtttagacggacctgtgattttt |
17543051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University