View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1399_high_60 (Length: 247)
Name: NF1399_high_60
Description: NF1399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1399_high_60 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 80 - 233
Target Start/End: Complemental strand, 40992141 - 40991988
Alignment:
| Q |
80 |
caggtgctacgtgatcgcttgaaaaatattcttcaagaggacgagatttttgtttgtgacatgacatctaggaagaggaatcgtgttgctgatgtaggtt |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40992141 |
caggtgctacgtgatcgcttgaaaaatattcttcaagaggacgagatttttgtttgtgacatgacatctaggaagaggaatcgtgttgctgatgtaggtt |
40992042 |
T |
|
| Q |
180 |
tttgtgatttccttaatttcttcttatgttacttataatctcagtttgcctgtt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40992041 |
tttgtgatttccttaatttcttcttatgttacttataatctcagtttgcctgtt |
40991988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University