View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1399_low_20 (Length: 411)
Name: NF1399_low_20
Description: NF1399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1399_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 110 - 348
Target Start/End: Complemental strand, 39711843 - 39711604
Alignment:
| Q |
110 |
atggatatttttattacttg-tttgatgatttatatttatacaattacattaagaaaagagcaatgaattattaatgatgtaaatgatggggggattatg |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39711843 |
atggatatttttattacttggtttgatgatttatatttatacaattacattaagaaaagagcaatgaattattaatgatgtaaatgatggggggattatg |
39711744 |
T |
 |
| Q |
209 |
tggggaaggtatttgaacgacagggactactttggaggatttgagcaagaagatttggatcaattattcgatgctatggcatcaaattacaaatcatggt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39711743 |
tggggaaggtatttgaacgacagggactactttggaggatttgagcaagaagatttggatcaattattcgatgctatggcatcaaattacaaatcatggt |
39711644 |
T |
 |
| Q |
309 |
gttctggatttgctccaatggcagttggaggggacatgga |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39711643 |
gttctggatttgctccaatggcagttggaggggacatgga |
39711604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 22 - 76
Target Start/End: Complemental strand, 39711931 - 39711877
Alignment:
| Q |
22 |
ctttcatctatggtattttcttaatttgtatgaaataatcaaatatcatacttat |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39711931 |
ctttcatctatggtattttcttaatttgtatgaaataatcaaatatcatatttat |
39711877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 215 - 349
Target Start/End: Original strand, 5737732 - 5737866
Alignment:
| Q |
215 |
aggtatttgaacgacagggactactttggaggatttgagcaagaagatttggatcaattattcgatgctatggcatcaaattacaaatcatggtgttctg |
314 |
Q |
| |
|
|||||||||||||| | | |||||||||||||||||||||||||||||| ||||||||||| | |||||||| |||||| ||| ||||||||| || |
|
|
| T |
5737732 |
aggtatttgaacgatgtgaattactttggaggatttgagcaagaagatttgaatcaattattcaacgctatggctgaaaattataaagcatggtgttatg |
5737831 |
T |
 |
| Q |
315 |
gatttgctccaatggcagttggaggggacatggat |
349 |
Q |
| |
|
||||||||||| |||| || || |||||||||||| |
|
|
| T |
5737832 |
gatttgctccactggccgtgggtggggacatggat |
5737866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University